$ gibbs

Usage(sites sampler): gibbs file lengths [options]

Usage(motif sampler): gibbs file lengths expect [options]

  lengths = <long>[,<long>]: lengths of elements for each type
  expect = <long>[,<long>]: expected number of elements for each type
  <long>[,<long>] = numbers for each element (e.g. "10,12,15" for 3 types)
  options:
        -C<real>    - prob. cutoff (0 < C <= 1) for near optimum sampling
        -c<int>     - number of cycles between shifts (sites sampler)
                      or maximum number of cycles per run (motif sampler)
        -d          - DON'T use fragmentation (i.e., column sampler)
        -f          - create a scan output file (file.sn)
        -I          - interactively specify #sites/sequence (sites sampler)
                      (default: one site of each type per sequence)
        -L<int>     - set rapid convergence limit (higher = longer to converge)
        -m<int>     - set maximum number of cycles in each run (sites sampler)
        -n          - use nucleic acid alphabet
        -o          - use element order in probabilities (sites sampler)
                      (each sequence must contain the same number of elements)
        -p<float>   - number of pseudo counts for product multinomial model
        -q<float>   - pseudo counts for ordering model (sites sampler)
        -R<int>     - set number of near-optimum readings taken
        -r          - randomly shuffle input sequences
        -s<int>     - give seed for random number generator
        -t<int>     - maximum number of sampling runs
        -x          - DON'T remove protein low complexity regions
        -w          - output wilcoxon rank test information (motif sampler)
        -W<float>   - set fractional weight (0 to 1.0) on priors (motif sampler)


lovelace$

lovelace$ more trna.tfa
>TRNA1     , 80 bases, 8CAAD343 checksum.
GGGGATGTAGCTCAGTGGTAGAGCGCATGCTTCGCATGTATGAGG
CCCCGGGTTCGATCCCCGGCATCTCCA
>TRNA2     , 80 bases, 211A9972 checksum.
GCGGCCGTCGTCTAGTCTGGATTAGGACGCTGGCCTCCCAAGCCAGCAA
TCCCGGGTTCGAATCCCGGCGGCCGCA
>TRNA3     , 80 bases, 1FA08758 checksum.
GGCCCTGTGGCTAGCTGGTCAAAGCGCCTGTCTAGTAAACAGGAGA
TCCTGGGTTCGAATCCCAGCGGGGCCTCCA
>TRNA4     , 80 bases, CB555AA6 checksum.
GGGCGAATAGTGTCAGCGGGAGCACACCAGACTTGCAATCTGGTAG
GGAGGGTTCGAGTCCCTCTTTGTCCACCA
>TRNA5     , 80 bases, 76BDF6E2 checksum.
GCCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTG
TCACCAGTTCAAATCTGGTTCCTGGCA
>TRNA6     , 80 bases, 82C57DF6 checksum.
GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGG
TCAGCGGTCGACCCGCTAGGCTCCACCA
>TRNA7     , 80 bases, 6CE4E09E checksum.
GGGCACATGGCGCAGTTGGTAGCGCGCTTCCCTTGCAAGGAAGAGG
TCATCGGTTCGATTCCGGTTGCGTCCA
>TRNA8     , 80 bases, 60753A8C checksum.
GGGCCCGTGGCCTAGTCTGGATACGGCACCGGCCTTCTAAGCCGGGGA
TCGGGGGTTCAAATCCCTCCGGGTCCG
>TRNA9     , 80 bases, 845D2EFF checksum.
CGGCACGTAGCGCAGCCTGGTAGCGCACCGTCCTGGGGTTGCGGGGG
TCGGAGGTTCAAATCCTCTCGTGCCGACCA
>TRNA10    , 80 bases, 90DD3035 checksum.
TCCGTCGTAGTCTAGGTGGTTAGGATACTCGGCTTTCACCCGAGAG
ACCCGGGTTCAAGTCCCGGCGACGGAACCA


lovelace$ gibbgs trna.tfa 8
bash: gibbgs: command not found
lovelace$ gibbs trna.tfa 8
Invalid (non-negative) expected score:  0.787

using blast amino acid frequencies
nconv = 500
** 1 **
 (new=9; old=4; w=9) 0.44898 motif A cycle 3
 (new=10; old=6; w=10) 0.875 motif A cycle 5
5 (new=4; old=5; w=10) 3.5 motif A cycle 6
 (new=5; old=8; w=10) 3.5 motif A cycle 7
 (new=8; old=1; w=9) 44[+] motif A cycle 8
 (new=10; old=7; w=10) 0.916667 motif A cycle 10
10 (new=5; old=6; w=10) 0.285714 motif A cycle 11
 (new=7; old=8; w=10) 3.5 motif A cycle 12
 (new=8; old=7; w=10) 3.5 motif A cycle 13
 (new=11; old=8; w=11) 1 motif A cycle 14
 (new=0; old=10; w=12) 0.4[-] motif A cycle 15
15 (new=14; old=12; w=14) 0.714286 motif A cycle 17
 (new=9; old=2; w=14) 1 motif A cycle 18
 (new=16; old=3; w=16) 0.967033 motif A cycle 19
** 2 **
 (new=9; old=3; w=9) 0.166667 motif A cycle 3
5 (new=3; old=8; w=9) 12.8333 motif A cycle 6
 (new=8; old=4; w=9) 3.5 motif A cycle 7
 (new=4; old=9; w=8) 7 motif A cycle 8
[++] 1  motif A cycle 8
 (new=10; old=1; w=9) 2[+] motif A cycle 9
 (new=8; old=5; w=9) 0.857143 motif A cycle 10
10 (new=10; old=8; w=10) 0.916667 motif A cycle 11
 (new=8; old=4; w=10) 1 motif A cycle 13
** 3 **
[+] 1  motif A cycle 3
 (new=9; old=7; w=9) 0.5 motif A cycle 4
 (new=7; old=9; w=8) 7 motif A cycle 5
[+] 1.16667  motif A cycle 5
5 (new=0; old=8; w=8) 1[-] motif A cycle 7
[-] 1  motif A cycle 7
 (new=9; old=2; w=9) 1.57143 motif A cycle 8
 (new=2; old=1; w=8) 7[+] motif A cycle 9
[++++] 1  motif A cycle 9
[-] 1  motif A cycle 10
[+] 0.857143  motif A cycle 11
[++++] 11.5238  motif A cycle 13
[+++] 9.87755  motif A cycle 14
[++] 0.857143  motif A cycle 15
15 (new=9; old=4; w=9) 0.44898 motif A cycle 17
** 4 **
[--] 1.16667  motif A cycle 3
[++] 1  motif A cycle 4
[++] 1  motif A cycle 5
[+++] 3.66667  motif A cycle 6
[---] 1.16667  motif A cycle 7
[-] 0.758621  motif A cycle 8
[+++] 7.40816  motif A cycle 9
 (new=9; old=1; w=8) 10.0833[+] motif A cycle 10
[++++] 417.366  motif A cycle 10
10 (new=9; old=1; w=8) 1[+] motif A cycle 11
[+] 1  motif A cycle 11
[++++] 108.653  motif A cycle 12
[++] 1  motif A cycle 13
[++] 3.14286  motif A cycle 15
15 (new=9; old=1; w=8) 34.5714[+] motif A cycle 16
[+++] 398.395  motif A cycle 16
[++++] 398.395  motif A cycle 17
 (new=0; old=6; w=9) 0.142857[-] motif A cycle 19
 (new=10; old=8; w=10) 0.25 motif A cycle 20
20 (new=7; old=2; w=10) 1 motif A cycle 21
 (new=11; old=7; w=11) 1.16667 motif A cycle 22
 (new=8; old=4; w=11) 0.333333 motif A cycle 23
 (new=13; old=6; w=13) 2 motif A cycle 24
 (new=4; old=9; w=13) 0.857143 motif A cycle 25
25 (new=14; old=4; w=14) 1.83333 motif A cycle 26
 (new=12; old=3; w=14) 3.66667 motif A cycle 27
 (new=15; old=11; w=15) 1.97436 motif A cycle 28
 (new=3; old=8; w=15) 0.318182 motif A cycle 29
best = 111.882; oldbest = 111.882


                        MOTIF A

 1-1    28  gtagagcgca TGCTTCGCA tgtatgaggc   36
 2-1    46  tcccaagcca GCAATCCCG ggttcgaatc   54
 3-1     1             GGCCCTGTG gctagctggt    9
 4-1    46  caatctggta GGGAGGGTT cgagtccctc   54
 5-1    47  aatcctcgtg TCACCAGTT caaatctggt   55
 6-1    15  ccttagctca GCTGGGAGA gcgcctgctt   23
 7-1    56  gtcatcggtt CGATTCCGG ttgcgtcca    64
 8-1    56  ggatcggggg TTCAAATCC ctccgggtcc   64
 9-1    51  gcgggggtcg GAGGTTCAA atcctctcgt   59
10-1    15  tcgtagtcta GGTGGTTAG gatactcggc   23
sites:                 * *******
                           5
        (10 sites in 10 sequences)

Motif model (residue frequency x 100):
POS    C  G  A  S  T  N  D  E  Q  K  R  H  W  Y  F  V  I  L  M  P  Info
   1   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   3   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   4   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   5   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   6   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   7   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   8   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   9   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
non-
site   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .
site   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .
8 columns

Information (relative entropy) contribution in tenth bits:
POS    C  G  A  S  T  N  D  E  Q  K  R  H  W  Y  F  V  I  L  M  P  Info
   1   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   3   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   4   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   5   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   6   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   7   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   8   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   9   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0

site   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0



Complete log-likelihood ratio  =  111 bits
Missing position information   =    2 bits
Log-likelihood ratio statistic =  108 bits
Degrees of freedom             =  152
Information per parameter      = 0.717 bits



                        MOTIF A

 1-1    28  gtagagcgca TGCTTCGCA tgtatgaggc   36 (1.25)
 2-1    46  tcccaagcca GCAATCCCG ggttcgaatc   54 (1.25)
 3-1     1             GGCCCTGTG gctagctggt    9 (1.25)
 4-1    46  caatctggta GGGAGGGTT cgagtccctc   54 (1.25)
 5-1    47  aatcctcgtg TCACCAGTT caaatctggt   55 (1.25)
 6-1    15  ccttagctca GCTGGGAGA gcgcctgctt   23 (1.25)
 7-1    56  gtcatcggtt CGATTCCGG ttgcgtcca    64 (1.25)
 8-1    56  ggatcggggg TTCAAATCC ctccgggtcc   64 (1.25)
 9-1    51  gcgggggtcg GAGGTTCAA atcctctcgt   59 (1.25)
10-1    15  tcgtagtcta GGTGGTTAG gatactcggc   23 (1.25)
sites:                 * *******
                           5
        (10 sites in 10 sequences)

Motif model (residue frequency x 100):
POS    C  G  A  S  T  N  D  E  Q  K  R  H  W  Y  F  V  I  L  M  P  Info
   1   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   3   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   4   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   5   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   6   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   7   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   8   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
   9   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .   0.0
non-
site   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .
site   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .
8 columns

Information (relative entropy) contribution in tenth bits:
POS    C  G  A  S  T  N  D  E  Q  K  R  H  W  Y  F  V  I  L  M  P  Info
   1   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   3   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   4   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   5   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   6   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   7   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   8   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0
   9   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0

site   .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .    0


    seed 425718694      time: 1 seconds (0.02 minutes)